Int J Pharm Pharm Sci, Vol 13, Issue 7, 28-31Original Article

STANDARDIZATION AND APPLICATION OF PCR TARGETING CHLORELLA SPECIES ISOLATED FROM ENVIRONMENTAL SAMPLES

PREMINA S.1, NIREN ANDREW S.1*, SUNDARALINGAM R.1, N. MURUGAN2, SHARANYA THERESA V.3

1Department of Microbiology, Madras Christian College, Chennai, Tamil Nadu, India 600059, 2Infectious Diseases-Molecular Genetics Division, Life Cell International Pvt Ltd., Tamil Nadu, India 613401, 3Departmentt of Biotechnology, Loyola College, Chennai, Tamil Nadu, India 600036
Email: nirenandrew@mcc.edu.in

Received: 05 Apr 2021, Revised and Accepted: 19 May 2021

ABSTRACT

Objective: Identification of Chlorella species from the environment through 18s ribosomal RNA sequencing. This study was aimed to design primer targeting Chlorella and other closely related algal species targeting 18s ribosomal RNA, ITS1 region.

Methods: Sanger sequencing was carried out for the identification of algae up to the genus and species level using an in-house designed primer and optimized PCR conditions.

Results: Out of 2 algae samples identified phenotypically, one isolate identified as Chlorella vulgaris and other one identified as Chlorella sorokiniana based on the results of Basic Alignment Search Tool (BLAST).

Conclusion: To conclude, this study provided primers with PCR conditions to characterize algal samples through molecular identification with 100% accuracy than the phenotypic method.

Keywords: Chlorella species, Microalgae, PCR, Primer designing, Sanger sequencing, Genotyping, Environmental samples

© 2021 The Authors. Published by Innovare Academic Sciences Pvt Ltd. This is an open access article under the CC BY license (https://creativecommons.org/licenses/by/4.0/)
DOI: https://dx.doi.org/10.22159/ijpps.2021v13i7.41701. Journal homepage: https://innovareacademics.in/journals/index.php/ijpps.

INTRODUCTION

Microalgae or microphytes are a ubiquitous group of fast-growing unicellular microscopic microphototrophs. Microalgae belong to phytoplankton can be isolated from freshwater and marine systems and they can survive in both the water column and sediment [1-3]. Pharmaceutically valuable products from microalgae and its industrial commercialization today is still in its infancy and can be seen as a gateway to a multibillion-dollar industry. They represent a major untapped resource of genetic potential for valuable bioactive agents and fine biochemical [4]. Compounds from microalgal extracts have been accepted as having greater biological and economic importance than dried biomass. In the sense of global population growth and availability of terrestrial food items, microalgae may provide sustainable and reliable replacements for widely used commodities of animal or plant origin. To date, however, only a limited number of strains have been utilised in nutritional and pharmaceutical purposes. Major research and development would entail the transition from a niche market to the widespread use of algal products as food commodities. In turn, this will include improving existing strains through genetic engineering, and modifications or screening new species to the growth of microalgae with increased targeted metabolite production [5]. In the environmental samples, they were found to be either as an individual or in chains or groups. Depending on the species, their sizes can range from a few micrometers (μm) to a few hundred micrometers. Environmentally, microalgae cultivation is considered a promising solution that mitigates global warming via sequestering the primary atmospheric greenhouse gas, CO2, by photosynthesis [1-3, 6, 7]. Screening of local microalgae species with high nutritional value and potential for oil production is essential to achieve successful commercial large-scale cultures. The species of the genus Chlorella are considered cryptic species that are morphologically similar but genetically distinct [8-10]. Chlorella vulgaris (ChV) is a unicellular microalga which contains a wide variety of antioxidant compounds including beta-carotene, chlorophyll, alfa-tocopherol, ascorbic acid, lycopene, lutein, zeaxanthin, Vitamin C, and Vitamin E [11]. The lack of obvious morphological taxonomic characteristics in addition to an exclusively asexual reproductive cycle through autospores makes it difficult to differentiate between the species of the genus Chlorella Beijerinck depending on the traditional taxonomy [10]. Sequences for the 18S rRNA gene were used to identify several microalgal species and in particular to differentiate species of Chlorella [12, 13]. In recent years, microalgae achieve high potential as a feedstock for biofuel production due to their several advantages such as higher biomass productivity, lesser water demand, and no agricultural land requirement compared to other energy crops [14-18].

The current study aimed to isolate, identify through phenotypic method and characterization through molecular method using unique primers designed by our group and standardization of the in-house primer targeting 18s ribosomal RNA for the identification of microalgae at the genus and species level.

MATERIALS AND METHODS

Sample collection and isolation of Chlorella

Water sample collected from Madras Christian College, Chennai in a sterile conical flask and cultured in Bold Basal medium. The growth of algae was maintained at 28 °C with 4000 lux light intensity for 30 d. Colonies were selected based on color differences and transferred to fresh agar plates. Microscopic observations at 100X magnification with oil immersion (Olympus Microscope) and serial dilution were made until a unialgal culture was obtained. After 30 d of growth, biomass was harvested. Post-harvest, 100 mg of wet cell biomass was washed with 100 mmolTris buffer (pH 7.5) and stored at-20 °C [16-18].

Genomic DNA extraction

Frozen cells were thawed and genomic DNA extraction was performed using HiPurA™ Plant Genomic DNA Miniprep Purification kit (MB507-50PR) as per the manufacturer instruction, in brief, ground material, immediately add 400 µl of Lysis Buffer (PL) (DS0016) containing Additive-I (DS0054) (preheated to 95 °C) and mix thoroughly and transferred to Hishredder, contaminants such as cell debris, salt precipitates are removed by centrifugation through a HiShredder and DNA isolated using HiElute Miniprep Spin Column (Capped) is based on the advanced silica binding principle presented in a microspin format and the DNA will be eluted finally using 200 µl Elution buffer.

Primer designing–In-house

To identify the Chlorella species, we downloaded all the Chlorella 18s ribosomal RNA, ITS1, 5.8S rRNA gene, ITS2, and 28S rRNA gene from NCBI databases. Multalin was performed for the downloaded set of sequences and identified the conserved region among the sequences. Further, the consensus sequence was uploaded to the Primer 3 software (http://bioinfo.ut.ee/primer3-0.4.0/) to obtain the desired set of primers and to determine the amplicon size for the gene of interest with optimum annealing temperature for three targets. The most appropriate pair of primers was selected using the NCBI BLAST tool (http://blast.ncbi.nlm.nih.gov/) using megablast and primer blast. Non-primer dimer formation was analyzed with a blastn tool. Based on a sequence alignment, chosen the primer length as 20 bp optimal and annealing temperature as an average of 60oc, selected the GC content above 55% for the optimal binding efficiency targeting 18s ribosomal RNA region to amplify internal fragments with the size of 410bp (table 1) [19, 20].

Table 1: In-house designed primer used for the amplification and sequencing of blue-green algae targeting 18s ribosomal RNA and ITs 1 region

Primer name Primer Seq 5'----3' Annealing temp Melting temp
Algae_NMN_SP_F TACGTGCGTAAATCCCGACT 60 56
Algae_NMN_SP_R ACCCGAAATCCAACTACGAG 60 56

PCR standardization

We used the Genomic DNA of known Chlorella species identified earlier microscopically. Primers were procured from Eurofins, India with 100 mmol concentration (table 2). Lyophilized primers were reconstituted using sterile 1x TE buffer to maintain the stability of the primer. The same was diluted further to obtain a 0.5 nM working concentration. 15 µl 2X Takara PCR premix (R004A) PCR Buffer containing Mgcl2, dNTPs, and Taq Polymerase were used for the PCR amplification. 5 µl of DNA added into the master mix and performed the Amplification as per the below conditions. Amplified products were analyzed by electrophoresis in a 2% agarose gel at 100 V for 1 h in 1X TAE [40 mmol Tris–HCl (pH 8.3), 2 mmol acetate and 1 mmol EDTA] containing 0.05 mg/l Ethidium bromide [19, 20].

Table 2: Thermal profile standardized for the amplification of 18s ribosomal RNA PCR

Conditions Temperature (C) Duration Step Cycle
Initial Denaturation 94 7 min 1 1
Denaturation 94 45 sec 2 40
Annealing 60 30 sec
Extension 72 45 sec
Final Extension 72 5 min 3 1
Hold 4 Infinity 4 1

DNA sequencing

Sanger sequencing was performed as per standard protocol [20]. Obtained results were analyzed after primary trimming of sequence with low-quality scores and subjected to blast in order to confirm the genotype of the targeted gene.

RESULTS

We isolated 15 blue-green algae colonies based on microscopical and cultural morphological studies. Chlorella species identified were observed macroscopically and the image is shown. Isolation of DNA was successful and found to be an average of 11ng/µl was estimated using Nanodrop (Spectrophotometer-Thermo Scientific). Primers were standardized for annealing temperature using Gradient PCR, where the optimal temperature was found to be 60 °C was fixed for further studies. Denaturation and Extension temperature was optimized as per the PCR Master mix instruction.

Two isolates of Blue-green algae were identified macroscopically, and both of them were amplified for the target 18s ribosomal RNA PCR. Confirmation of PCR standardization carried out using known Blue-green algae DNA used as Positive control, and no template control (NTC) was used to confirm the false-positive amplification and quality control of the reaction mixture. Both positive control and two test samples NMNSP1 and NMNSP2 were amplified and no amplification was found in the NTC sample (fig. 1).

DNA sequencing

Sanger sequencing was carried out using the reverse primer processed for PCR amplification of two Samples, which showed amplification, and the generated ABI file was analyzed using Bioedit software, all the chromatogram peaks were checked for the quality control (fig. 2) and the best regions were downloaded as FASTA format and the same were analyzed using NCBI Blast tool. Blast results showed the given sequence was 100% homology to Chlorella species (fig. 3) and above 30 targets were matching with Chlorella vulgaris for sample NMN_SP and Chlorella sorokiniana for the sample NMN_SP2, hence it was submitted to NCBI Genbank and approved by the NCBI team and released the data under NCBI Accession ID: MW847613; and MW858375 respectively.

Fig. 1: Agarose gel electropherogram showing positive amplification for two isolates obtained from environmental samples labelled as NMN_SP1 and NMN_SP2. Know Algal DNA used as positive control showed amplification and NTC (Master mix+Nuclease free water as sample) showed no amplification

Fig. 2: ABI file-chromotogram of Chlorella vulgaris_NMN_SP

Fig. 3: NCBI blast results shows 100% homology with Chlorella vulgaris

DISCUSSION

The microscopic observations of this work are in agreement with those recorded for the genus Chlorella Beijerinck. Though Phenotypically both NMNSP1 and NMNSP2 identified as Chlorella species. But the species level identification was not accurate through the phenotypic method. Hence this study has proven the need for molecular identification of algal identification though the molecular method provides accurate identification than the phenotypic method. Basic Local Alignment Search Tool of the National Center for Biotechnology Information (NCBI BLAST) of Chlorella sp. NMN_SP sequence has shown close relationships (100% identity and 98% query cover) between highly dissimilar morphologies such as Chlorella sorokiniana NKH6 gene (LC505542.1) and Micractinium sp. KSF0094 (MN414469.1) demonstrating that the evolution of vegetative morphology can be rapid. Further, NMNSP2 showed 100 % homology to Chlorella sorokiniana, and the same has been published under NCBI database. The growth of Chlorella vulgaris NMN_SP1 and Chlorella sorokiniana NMN_SP2 reached an exponential phase at day 20, almost similar to the duration period of Chlorella marina reported by Muthukumar et al. [21]. The resulted generation time (g), the mean time required to double the population, was 2.54 d. Consequently, the growth rate constant (K), the number of generations per unit time, was at 0.393 generations/day; and the maximum biomass (M) was 135.65 × 106 cells/ml. This agrees to some extent with the results reported by Rosenberg et al. [22] for different Chlorella spp. The maximum biomass production is similar to that recorded for Chlorella vulgaris by Montoya et al. [23] using nitrogen-limited Bold basal medium provided with 4% CO2-enriched air, also by El-Mohsnawy et al. [24]. The isolated Chlorella vulgaris NMN_SP has been further studied for the biosynthesis of copper oxide nanoparticles (Cuo NPs), studies reported on characterization, optimization, and antimicrobial studies of the nanoparticles by our team early [25]. The biosynthesized CuO NPs was confirmed visually by the appearance of dark brown color formation in the mixture added with copper acetate. The existence of nanoparticles was confirmed by UV visible spectroscopy at 540 nm. Biosynthesized nanoparticles were characterized by SEM, EDAX, and XRD. Further, antimicrobial potential studies of synthesized CuO NPs were carried out against selected bacteria and fungi. Literature suggests that the Chlorella vulgaris plays a vital role in both bioenergy production and Food with rich protein sources varies from 42 to 58% of its biomass dry weight [1-3, 6-13].

The current study aims to design the primer against universal target gene 18s ribosomal RNA and ITS1 and ITS2 region to characterize the identified algae up to the species level detection. Primer designing and synthesis were successful and the standardization of PCR was obtained with all the tested samples and the available known positive algal DNA. Further to confirm the primer has no cross binding with any other bacteria or fungal also evaluated using specificity test. Two Gram-positive bacteria–Staphylococcus aureus and Streptococcus pneumonia and two Gram-negative bacteria–Escherichia coli and Pseudomonas aeruginosa, One fungal DNA–Aspergillus flavus was used for specificity test and all the non-algal DNA samples found to be negative as per our expectation. Blast analysis also showed that the designed primer was highly specific to Blue-green algae, especially with Chlorella species. Since our target was Chlorella, we have chosen the region of the gene which is highly conserved among the Chlorella species and the same has been evaluated both phenotypically and genotypically.

CONCLUSION

The study aims to design and standardize PCR for Blue-green algae, specifically to Chlorella species was successfully achieved and the designed primers were optimized and amplified the target regions without any cross-reaction, primer dimer formation, and nonspecific band formation. Further sequencing confirmed the species as Chlorella vulgaris and its unique sequence given the name NMN_SP as a strain name. Further studies on this Chlorella vulgaris will provide us a better understanding of the potential activities as antimicrobial, anticancer, antidiabetic, and other industrially beneficial pharmaceutical products. 

FUNDING

Nil

AUTHORS CONTRIBUTIONS

All the authors have contributed equally.

CONFLICT OF INTERESTS

Declared none

REFERENCES

  1. El-Sheekh M, Abu-Faddan M, Abo-Shady A, Nassar MZA, Labib W. Molecular identification, biomass, and biochemical composition of the marine chlorophyte Chlorella sp. MF1 isolated from suez bay. J Genet Eng Biotechnol 2020;18:1-10.

  2. "Chlorella vulgaris". NCBI taxonomy. Bethesda, MD: National Center for Biotechnology Information. Other names: synonym: Chlorella vulgaris var. viridis Chodat includes: Chlorella vulgaris Beijerink IAM C-27 formerly Chlorella ellipsoidea Gerneck IAM C-27; 2017.

  3. Duval B, Margulis L. "The microbial community of Ophrydium versatile colonies: endosymbionts, residents, and tenants. Symbiosis 1995;18:181–210.

  4. Meenakshi Bhattacharjee. Pharmaceutically valuable bioactive compounds of algae. Asian J Pharm Clin Res 2016;9:43-7.

  5. Jinu Medhi, Mohan Chandra Kalita N. Emerging aquatic green gold for food and medicine: a review of algae from north east India. Int J Pharm Pharm Sci 2020;12:7-15.

  6. Safi C, Zebib B, Merah O, Pontalier PY, Vaca-Garcia C. "Morphology, composition, production, processing and applications of Chlorella vulgaris: a review". Renew Sust Energ Rev 2014;35:265–78.

  7. Kitada K, Machmudah S, Sasaki M, Goto M, Nakashima Y, Kumamoto S, et al. "Supercritical CO2 extraction of pigment components with pharmaceutical importance from Chlorella vulgaris". J Chem Technol Biotechnol 2009;84:657–61.

  8. Wang B, Li Y, Wu N, Lan CQ. CO2 bio-mitigation using microalgae. Appl Microbiol Biotechnol 2008;79:707–18.

  9. Satpati GG, Pal R. Microalgae-biomass to biodiesel: a review. J Algal Biomass Util 2018;9:11–37.

  10. Muller J, Friedl T, Hepperle D, Lorenz M, Day JG. Distinction between multiple isolates of Chlorella vulgaris (Chlorophyta, Trebouxiophyceae) and testing for conspecificity using amplified fragment length polymorphism and ITS rDNA sequences. J Phycol 2005;41:1236-47.

  11. Zamri KS, Norripin MKN, Darus FI, Ekambaram DG, Abdul Raof ND, Roslan NH, et al. Protective effect of Chlorella vulgaris on DNA damage, oxidative stress, and lung morphological changes in cigarette smoke-exposed rats. Asian J Pharm Clin Res 2018;11:145-9.

  12. Baytut O, Gurkanli CT, Gonulol A, Ozkoc I. Molecular phylogeny of Chlorella-related chlorophytes (Chlorophyta) from anatolian freshwaters of turkey. Turk J Bot 2014;38:600-7.

  13. Huss V, Frank C, Hartmann E, Hirmer M, Kloboucek A, Seidel B, et al. Biochemical taxonomy and molecular phylogeny of the genus Chlorella sensu lato (Chlorophyta). J Phycol 1999;35:587-98.

  14. Wan M, Rosenberg JN, Faruq J, Betenbaugh MJ, Xia J. An improved colony PCR procedure for genetic screening of Chlorella and related microalgae. Biotechnol Lett 2011;33:1615-9.

  15. Tear C, Lim C, Wu J, Zhao H. Accumulated lipids rather than the rigid cell walls impede the extraction of genetic materials for effective colony PCRs in Chlorella vulgaris. Microb Cell Fact 2013;12:106-12.

  16. El-Sheekh MM, Gheda SF, El-Sayed A, Abo Shady A, El-Sheikh M, Schagerl M. Outdoor cultivation of the green microalga Chlorella vulgaris under stress conditions as a feedstock for biofuel. Environ Sci Pollut Res 2019;26:18520-32.

  17. Machado RR, Lourenço SO. Propriedades nutricionais de microalgas usadas como alimento de moluscos bivalves: uma revisao. Museu Nacional Serie Livros 2008;30:281-304.

  18. Borges Campos V, Barbarino E, Lourenço SO. Crescimento e composicao quimica de dez espécies de microalgas marinhas em cultivos estanques. Cienc Rural 2010;40:339–47.

  19. Murugan N, Malathi J, Therese KL, Madhavan HN. Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes. Kaohsiung J Med Sci 2018;34:79-88.

  20. Bharathi MJ, Murugan N, Rameshkumar G, Ramakrishnan R, Reddy YCV, Shivkumar C, et al. Comparative evaluation of uniplex, nested, semi-nested, multiplex and nested multiplex PCR methods in the identification of microbial etiology of clinically suspected infectious endophthalmitis. Curr Eye Res 2013;38:550-62.

  21. Muthukumar A, Elayaraja S, Ajithkumar TT, Kumaresan S, Balasubramanian T. Biodiesel production from marine microalgae Chlorella marina and Nannochloropsis salina. J Pet Technol Altern Fuels 2012;3:58–62.

  22. Rosenberg JN, Kobayashi N, Barnes A, Noel EA, Betenbaugh MJ, Oyler GA. Comparative analyses of three Chlorella species in response to light and sugar reveal distinctive lipid accumulation patterns in the microalga C. sorokiniana. PLoS One 2014;9:e92460.

  23. Montoya EYO, Casazza AA, Aliakbarian B, Perego P, Converti A, De Carvalho JCM. Production of Chlorella vulgaris as a source of essential fatty acids in a tubular photobioreactor continuously fed with air enriched with CO2 at different concentrations. Biotechnol Prog 2014;30:916-22.

  24. EL-Mohsnawy E, El-Sheekh MM, Mabrouk M, Zoheir W. Enhancing accumulation of omega 3 and 9 fatty acids in Chlorella vulgaris under mixotrophic nutrition. J Anim Plant Sci 2020;30:485-92.

  25. Premina S, Sundaralingam R, Niren Andrew S. Biosynthesis, characterization and antimicrobial potential studies of copper oxide nanoparticle produced from Chlorella vulgaris. P Ind J Res 2020;9:3.