Int J Pharm Pharm Sci, Vol 7, Issue 10, 327-330Original Article


SEROPREVALENCE AND GENOTYPING OF HEPATITIS C VIRUS AMONG HOSPITAL BASED GENERAL POPULATION IN VIJAYPUR, INDIA

MANJUNATH P. SALMANI1, BASAVARAJ V. PEERAPUR2

Associate Professor, Department of Microbiology, Shri B. M. Patil Medical College, H&RC, Solapur Road, Vijaypur 586103, Karnataka
Email: drsalmani@rediffmail.com   

 Received: 15 Jul 2015 Revised and Accepted: 26 Aug 2015

ABSTRACT

Objective: Hepatitis C virus (HCV) has emerged as a leading cause of chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. According to World Health Organization (WHO) there are 180 million people affected with HCV worldwide and about 12.5 million carriers in India. Genotypes of HCV can vary in pathogenecity and can impact on treatment outcome. Hence this study was undertaken to know the seroprevalence and different genotypes of HCV among hospital based general population in Vijaypur, Karnataka.

Methods: Study subjects were those attending various Out-Patient Department (OPD) and In-Patient Department (IPD) of Shri B. M. Patil Medical College, Hospital and Research Centre, Vijaypur, Karnataka. 5 ml of blood sample was aseptically collected in plain vial from the study subjects. Serum was separated and aliquoted in different vials. All the 1,200 serum samples were tested for HCV antibodies by third generation Enzyme Linked Immunosorbent Assay (ELISA). The serum samples positive by ELISA were tested for HCV RNA by Reverse Transcription Polymerase Chain Reaction (RT-PCR). Serum samples positive for HCV RNA were subjected to geno typing by RFLP (Restriction Fragment Length Polymorphism) and direct sequencing.

Results: Of the 1,200 samples tested, 32 (2.6%) were positive for anti-HCV antibody and 25 (2.1%) were positive for HCV RNA. HCV genotype 1 (68%) was found to be the most predominant type followed by genotype 3 (32%). The subtypes of genotype 1 were 1a and 1b, whereas subtypes of genotype 3 were 3a and 3b.

Conclusion: The seroprevalence of HCV in this study was 2.6% and HCV genotype 1 and genotype 3 were found to be the predominant genotypes respectively. For physicians, knowing the genotype of hepatitis C virus is helpful in deciding type and duration of therapy. In addition, knowledge of circulating genotypes could impact on future vaccine formulations.

Keywords: Seroprevalence, RT-PCR, RFLP, Sequencing Genotype, Subtype.

© 2016 The Authors. Published by Innovare Academic Sciences Pvt Ltd. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/)

INTRODUCTION

Hepatitis C virus (HCV), since its discovery in 1989, has been considered a leading cause of chronic hepatitis which can progress to liver cirrhosis and hepatocellular carcinoma [1]. According to World Health Organization (WHO), there are 180 million people infected with HCV worldwide [2] and about 12.5 million carriers in India [3].

HCV is an enveloped positive strand ribonucleic acid (RNA) virus belonging to genus hepaci virus in the family flaviviridae [4]. The RNA genome comprises of about 9500 nucleotides with a single open reading frame that encodes a polypeptide precursor of 3000 amino acids and is flanked by the non coding regions at both the 5’ and the 3’ termini [5].

The poly protein precursor is cotranslationally processed by host signal peptides to yield the structural (core [c] and envelope [E1 and E2]) and the non-structural proteins (NS1, NS2, NS3, NS4A, NS4B, NS5A and NS5B) [6].

HCV has been classified into six major genotypes and into more than 90 subtypes distributed across the world [7]. The HCV genotypes too have distinct geographical distribution and may have a bearing on the duration of treatment and outcome, [8] although the impact of HCV genotype in progression of the disease is still controversial [7]. Studies in India have revealed a seroprevalence of 1.8% of HCV infection among general population [9].

The conventional antiviral therapy against HCV is either mono therapy with interferon (IFN) or in combination with ribavirin [7]. The response to therapy differs across genotypes, while up to 80% of the genotypes 2 and 3 can be cured with standard of care treatment consisting of pegylated or standard IFN-α and ribavirin, [10]. geno types 1, 4, 5 and 6 have been reported to show poorer response. In the present study, we estimated the seroprevalence and analyzed the genotypes of HCV among hospital based general population in Vijaypur. Our study will help in knowing the seroprevalence and genotypes of HCV prevalent in this region, which in turn helps to choose appropriate treatment for HCV infection.

MATERIALS AND METHODS

The study was conducted in Department of Microbiology, Shri B. M. Patil Medical College (SBMPMC), H & RC, Vijaypur, Karnataka. All patients attending Out-Patient Department (OPD) and In-Patient Department (IPD) of SBMPMC, H & RC from April 2011 to July 2014 were included in the study. A detailed medical history including risk factors was taken. The study protocol was approved by an Institutional Ethics Committee of BLDE University, Vijaypur. Informed consent was taken from all the patients. Proforma was maintained for each patient containing clinical information about his/her previous exposure to risk factors.

5 ml of blood sample was aseptically collected in plain vial from the study subjects. Serum was separated and aliquoted in different vials and stored at-70 °C until tested. Repeated freezing and thawing were avoided. The following tests were performed on serum samples:

Serological studies

Anti-HCV antibodies-using commercially available third generation ELISA Kits which comprised of Core, E1, E2, NS3, NS4 and NS5 antigens of HCV (SD HCV ELISA, Bio Standard Diagnostics Pvt Ltd, India), as per manufacturer instructions. Anti-HCV antibodies positive samples were further processed for the next step evaluation.

Viral RNA extraction

HCV viral RNA was extracted from the serum samples positive for HCV antibodies using Qiagen (Germany) RNA according to manufacturers’ instructions. HCV RNA was extracted from serum and eluted in 50 µl of elution buffer. Eluted RNA was stored at-70 °C until further processed.

Detection of HCV RNA by RT-PCR

RT-PCR was carried out by the modified method of Mellor et al. The RNA was denatured by heating at 70 °C for 3 min prior to RT-PCR, and reverse transcribed at 42 °C for 60 min, in a PCR tube containing 1X RT buffer, 10 mM deoxyribonucleoside triphosphates, 20 U RNase inhibitor, 50 U murine leukemia virus reverse transcriptase, 20 pmol primer (core region P1: 5 × ATGTACCCCATGAG/TA/GTCGGC 3 × anti-sense) to a final volume of 20 µl. The c-DNA product was denatured at 95 °C for 5 min, then cooled at 4 °C for 5 min and used for direct PCR.

Direct polymerase chain reaction

Direct PCR was performed in the reaction mixture containing PCR buffer (10×), 2 mM MgCl2, 10 mM deoxynucleotide triphosphates (dNTPs), 20 pmoles primers (sense P2: 5′ACTGCCTGATAGGGTGC TTGCG AG 3′) and anti-sense (P1: 5′ ATGTACCCCATGAG/TA/GTCGGC 3′) for 5 × NCR core region, 0.75 U Taq Deoxyribonucleic Acid (DNA) polymerase, in a total reaction volume of 25 µl.

Nested-PCR was performed in a reaction mixture containing PCR buffer (10×) 2 mM MgCl2, 10 mM dNTPs, 20 pmoles primers (sense P3: 5′ ACTGCCTGATAGGGTGCTTG CGAG3′) and anti-sense (P4: 5’ ATGTACCCCATGAG/TA/GTCGGC 3′) for 5 × NCR core region, 0.75 U Taq DNA polymerase, in a total reaction volume of 25 µl.

Amplified PCR product was electro phoresed in ethidium bromide stained 2% nu sieve agarose gel with commercially available 100 bp DNA marker (Fermentas). Specific bands of HCV were visualized under ultraviolet light of Wealtec gel doc system. Positive and negative controls were also included.

HCV RNA quantification

Quantitative HCV RT-PCR was performed using the light cycler taqman master mix kit (Roche Diagnostics GmbH, Mannheim, Germany) on Roche Light cycler as per manufacturer’s instructions.

The unit of the HCV RNA quantification was copies/ml. The range of standard used in quantitative analysis was 102-108copies/ml.

HCV genotyping

The restriction fragment length polymorphism (RFLP) analysis was carried out using the nested PCR product of RNA positive samples (20-30 µl). The amplified nested PCR product was digested with three enzymes Accl, Mbol and BstN1 and incubated at 37 °C for overnight in a specific endonuclease buffer. The digested product was loaded onto 3% nu sieve agarose gel and the restriction pattern was analyzed using Wealtec gel doc System (fig. 1 and 2). The RFLP was followed by direct sequencing for determination of HCV genotype. The nested PCR product and the sense primer were used for sequencing reaction.

Fig. 1: The RFLP pattern of HCV genotype. Lane 1: 100 bp marker, Lane 2 and 4: genotype 1b (234 bp), Lane 5: Negative control, Lane 7: genotype 3b (176 bp), Lane 8 and 10: genotype 3a (232 bp)


Fig. 2: The RFLP Pattern of HCV genotype. Lane 1: 100 bp DNA marker, Lane 2: Negative control, Lane 3: genotype 1a (209 bp)

RESULTS

A total of 1,200 patients were recruited in the study. Majority of these patients belonged to Vijaypur city and the neighboring small towns and villages. Of the 1,200 patients screened, 32 (2.6%) were found positive for ant-HCV antibody. Age and sex distribution of hospital based general population with HCV seropositivity is shown in table 1 below:

Table 1: Age and sex distribution of hospital based general population with HCV seropositivity

Age

Group (In years)

Males

Males anti-HCV positive (In %)

Females

Females anti-HCV positive (In

%)

Total anti-HCV

Positive (In %)

0-9

105

1(0.95%)

91

1(1.1%)

2(1.02%)

10-19

97

2(2.1%)

99

1(1.0%)

3(1.53%)

20-29

110

3(2.7%)

92

2(2.2%)

5(2.48%)

30-39

108

3(2.8%)

96

5(5.2%)

8(3.92%)

40-49

116

7(6.0%)

90

3(3.3%)

10(4.63%)

≥50

110

2(1.8%)

86

2(2.3%)

4(2.04%)

Total

646

18(2.8%)

554

14(2.5%)

32(2.6%)

25 (2.1%) out of 32 were found to have active infection (HCV RNA positive). 25 HCV RNA positive samples were subjected to genotype determination using RFLP followed by direct sequencing. Genotype 1 was the commonest type observed in 17 (68%) patients followed by genotype 3 in 8 (32%) patients. Among genotype 1, subtypes 1a and 1b were most commonly isolated. In genotype 3 subtypes 3a and 3b were most frequently isolated.

Genotypes 1a and 1b were observed in 10 (58.8%) and 7 (41.2%) patients respectively whereas types 3a and 3b were seen in 3 (37.5%) and 5 (62.5%) patients respectively. Out of 25 PCR positive patients, 15 (60%) were males and 10 (40%) were females. Distribution pattern of HCV genotypes according to the gender is given below in table 2.

Table 2: Distribution pattern of HCV genotypes according to age

Gender

Genotype

Genotype

Genotype

Genotype

1a

1b

3a

3b

Male (N=15) (60%)

6 (40%)

4 (26.7%)

2 (13.3%)

3 (20%)

Female (N=10) (40%)

4 (40%)

3 (30%)

1 (10%)

2 (20%)

Total (N=25) (100%)

10 (40%)

7 (28%)

3 (12%)

5 (20%)

N=Number, Distribution pattern of HCV genotypes according to the age is given below in table 3


Table 3: Distribution pattern of HCV genotypes according to age

Age

Genotype

Genotype

Genotype

Genotype

1a

1b

3a

3b

˂ 18 (N=4) (16%)

2 (50%)

2 (50%)

0 (0%)

0 (0%)

18-40(N=9) (36%)

4 (44.4%)

2 (22.2%)

0 (0%)

3 (33.3%)

41-60(N=12) (48%)

4 (33.3%)

3 (25.0%)

3 (25.0%)

2 (16.7%)

Total (N=25) (100%)

10 (40.0%)

7 (28.0%)

3 (12.0%))

5 (20.0%)

N=Number

Viral load quantification was carried out in HCV RNA positive patients. The average viral load of patients infected with genotype 1 was significantly higher than those infected with genotype 3.


DISCUSSION

Currently India harbors an estimated 10-15 million chronic carriers of HCV, which is a major cause of liver related mortality and morbidity.Overall a seropositivity of 2.6% was observed among hospital based general population in this study. This is similar to other hospitalsbased study done in 2002 by S Mishra et al. [11] in contrast to the study done by S Bhattacharya et al. (which showed a seroprevalence of 4.8%) [12]. The prevalence seems to increase with age because of the continuing risk of exposure The prevalence of HCV in the 0-9 y’s age group could be due to the enhanced risk of exposure from perinatal transmission of the virus. In conformity with other studies, a higher prevalence was found among males (2.8%) than among females (2.5%).

Knowledge of genotype is crucial for management of HCV infection and prediction of prognosis. [13]. HCV genotypes show differing distributions in different geographic regions. In the United States, about 70% of cases are caused by genotype1, 20% by genotype2 and about 1% by each of the other genotypes [14]. Genotype 1 is also the most common in South America and Europe [15]. In India, genotype 3 has been predominant in the Northern, Eastern as well as Western region [16] while in South India, genotypes 1 and 3 have been reported in decreasing order of frequency [17]. Genotype 3 has also been reported to be the commonest type from the neighboring countries of Nepal and Pakistan, while in the eastern countries of Thailand, Vietnam and Japan, genotype 1 is the most prevalent [18].

The most common genotypes isolated in our study were 1 and 3 respectively. Our finding correlates well with the study conducted by Raghuraman S et al. in 2004. Knowledge of regional distribution of HCV genotypes is important since this could influence the configuration of diagnostic assays as well as vaccine designs. [17]. within genotype 1, we observed that subtype 1a (58.8%), the current most prevalent sub type.

According to our study, in the group of patients of age less than 18 y 50% of patients were found to be infected with HCV genotype 1a and also 50% 0f patients with 1b. In the age group 18-40 y, 44.4% had 1a genotype infection, 22.2% showed 1b genotype infection while 33.3% showed 3b genotype infection of HCV. The patients of age group 41-60 y showed the percentage to be 33.3% of 1a, 25% of 1b, 25% of 3a and 16.7% 0f 3b. Genotypes 3a and 3b were not found in age group of less than 18 y and 3a genotype was not found in age group 18-40 y.

Our study showed no significant difference in genotype distribution in relation to gender. Various genotypes were equally distributed in relation to gender.

HCV plasma viral load, also called HCV viremia, is expressed in copies per milliliter. In our study, we used PCR to quantify HCV viremia. In our study, mean HCV RNA were higher in patients infected with HCV type 1 than in patients infected with HCV type 3. Our result correlated well with a study conducted [19].

For physicians, knowing the genotype of hepatitis C is helpful in deciding type and duration of therapy [20]. Several clinical trials of pegylated interferon/ribavirin therapy have revealed significant differences in response rates for the various HCV genotypes. Individuals with genotypes 2 and 3 are more likely than individuals with genotype 1 to respond to therapy with alpha interferon or the combination of alpha interferon and ribavirin [21].

One probable reason for more treatment failures with HCV genotype 1 could be its efficient replication ability enabling it to establish higher viral RNA compared to other genotypes. [22]. In the present study, patients with HCV genotype 1 had significantly higher viral load as compared to genotype 2 and 3. Patients with high viral load present a poor response to interferon therapy than those with lower levels. The probability of a relapse after cessation of therapy is higher in patients with high HCV RNA copy numbers prior to therapy [23].

CONCLUSION

There is a scarcity of information on HCV prevalence particularly in developing counties like India. Our study on the prevalence of HCV infection among hospital based general population is sure to provide a useful insight to researchers working on HCV infection. There is an association between different types of genotypes and viral load. Further studies should be carried out to determine the association of viral load with different genotypes.The information provided by the present study provides valuable information to physicians in clinical decision making. For physicians, knowing the genotype of hepatitis C is helpful in deciding type and duration of therapy. A continued monitoring of HCV genotypes is essential for the optimum management of chronically infected patients. In addition, knowledge of circulating genotypes could impact on future vaccine formulations.

CONFLICT OF INTERESTS

Declared None

REFERENCES

  1. Hofgärtner WT, Polyak SJ, Sullivan DG, Jr Carithers RL, Gretch DR. Mutations in the NS5A gene of hepatitis C virus in north american patients infected with HCV genotype 1a or 1b. J Med Virol 1997;53:118-26.
  2. Hepatitis C. Initiative for vaccine research. World Health Organization WHO; 2009. Available from: URL: http://www.who.int/vaccine_research/diseases/viral_cancers/en/index2.html. [Last accessed on 06 Aug 2011].
  3. Chattopadhyay S, Hepatitis C. A major health problem of India. Curr Sci 2002;83:9.
  4. Choo QL, Richman KH, Han JH, Berger K, Lee C, Dong C, et al. Genetic organization and diversity of the hepatitis C virus. Proc Natl Acad Sci USA 1991;88:2451-5.
  5. Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 1989;244:359-62.
  6. Hijikata M, Kato N, Ootsuyama Y, Nakagawa M, Shimotohno K. Gene mapping of the putative structural region of the hepatitis C virus genome by in vitro processing analysis. Proc Natl Acad Sci USA 1991;88:5547-51.
  7. Hoofnagle JH. Course and outcome of hepatitis C. Hepatology 2002;36:S21-9.
  8. Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, Jr Gonçales FL, et al. Peginterferon alpha-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med 2002;347:975-82.
  9. Panigrahi AK, Panda SK, Dixit RK, Rao KU, Acharya SK, Dasrathy S, et al. Magnitude of hepatitis C virus infection in India: Prevalence in healthy blood donors, acute and chronic liver disease. J Med Virol 1997;51:167-74.
  10. Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, Reindollar R, et al. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomized trial. Lancet 2001;358:958-65.
  11. Mishra S, Chayani N, Sarangi G, Mallick B, Patil SB. Seroprevalence of anti HCV antibody in and around Cuttack, Orissa. Indian J Med Microbiol 2002;20:40-1.
  12. Bhattacharya S, Badrinath S, Hamide A, Sujatha S. Seroprevalence of hepatitis C virus in a hospital based general population in South India. Indian J Med Microbiol 2003;21:43-5.
  13. Hadziyannis SJ, Jr Sette H, Morgan TR, Balan V, Diago M, Marcellin P, et al. Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: A randomized study of treatment duration and ribavirin dose. Ann Intern Med 2004;140:346-55.
  14. Wilkins T, Malcolm JK, Raina D, Schade RR. Hepatitis C: diagnosis and treatment. Am Fam Physician 2010;81:1351-7.
  15. Rosen HR. Clinical practice. Chronic hepatitis C infection. N Engl J Med 2011;364:2429-38.
  16. Hissar SS, Goyal A, Kumar M, Pandey C, Suneetha PV, Sood A, et al. Hepatitis C virus genotype 3 predominates in North and Central India and is associated with significant histopathologic liver disease. J Med Virol 2006;78:452-8.
  17. Raghuraman S, Abraham P. HCV genotyping in India-Quo Vadis? Indian J Med Res 2004;119:9-11.
  18. Idrees M, Riazuddin S. Frequency distribution of hepatitis C virus genotypes in different regions of Pakistan and their possible routes of transmission. BMC Infect Dis 2008;8:69.
  19. Nabi SG, Zaffar G, Sheikh NI, Hassan K, Hassan U. Hepatitis C virus genotypes: A plausible association with viral loads. Indian J Pathol Microbiol 2013;56:384-7.
  20. Paraboni ML, Sbeghen MD, Wolff FH, Moreira LB. Risk factors for infection with different hepatitis C virus genotypes in southern Brazil. Sci World J 2012. doi: 10.1100/2012/946954. [Article in Press]
  21. Pujol FH, Loureiro CL. Replacement of hepatitis C virus genotype 1b by genotype 2 over a 10 y period in venezuela. J Clin Gastroenterol 2007;41:518-20.
  22. Pang PS, Planet PJ, Glenn JS. The evolution of the major hepatitis C genotypes and correlates with clinical response to interferon therapy. PLoS One 2009;4:e6579.
  23. Dusheiko G, Schmilovitz-Weiss H, Brown D, McOmish F, Yap PL, Sherlock S, et al. Hepatitis C virus genotypes: an investigation of type specific differences in geographic origin and disease. Hepatology 1994;19:13-8.